|
HAOYANG LTD
lymphocyte separation medium haoyang bio Lymphocyte Separation Medium Haoyang Bio, supplied by HAOYANG LTD, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/pm35782327-158-13-16?v=HAOYANG+LTD Average 90 stars, based on 1 article reviews
lymphocyte separation medium haoyang bio - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
R&D Systems
magcellect mouse cd8 t cell isolation kit ![]() Magcellect Mouse Cd8 T Cell Isolation Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/pmc12878432-40-32-40?v=R%26D+Systems Average 94 stars, based on 1 article reviews
magcellect mouse cd8 t cell isolation kit - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
ATCC
style single i acaatcc i u acc 4358 g tr24 76 gctttaaatcaactatctgactgtctcttatacacatc b1 t 57 g tr24 ataga u ![]() Style Single I Acaatcc I U Acc 4358 G Tr24 76 Gctttaaatcaactatctgactgtctcttatacacatc B1 T 57 G Tr24 Ataga U, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/us10941176-4925-17-39?v=ATCC Average 94 stars, based on 1 article reviews
style single i acaatcc i u acc 4358 g tr24 76 gctttaaatcaactatctgactgtctcttatacacatc b1 t 57 g tr24 ataga u - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
ATCC
dissimilar penetration ![]() Dissimilar Penetration, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/10__1080_slash_1040841x__2018__1538934-37-31-17?v=ATCC Average 96 stars, based on 1 article reviews
dissimilar penetration - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Cellular Technology Ltd
term b cell elispot assay ![]() Term B Cell Elispot Assay, supplied by Cellular Technology Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/pmc09988862-341-1-40?v=Cellular+Technology+Ltd Average 96 stars, based on 1 article reviews
term b cell elispot assay - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Valiant Co Ltd
ficoll density gradient centrifugation ![]() Ficoll Density Gradient Centrifugation, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/pm19826812-59-10-18?v=Valiant+Co+Ltd Average 96 stars, based on 1 article reviews
ficoll density gradient centrifugation - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
10X Genomics
assays b cell single cell v d j solution 10x genomics n a expifectaminetm 293 transfection kit thermo fisher cat ![]() Assays B Cell Single Cell V D J Solution 10x Genomics N A Expifectaminetm 293 Transfection Kit Thermo Fisher Cat, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/pm41192421-286-194-201?v=10X+Genomics Average 86 stars, based on 1 article reviews
assays b cell single cell v d j solution 10x genomics n a expifectaminetm 293 transfection kit thermo fisher cat - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
New England Biolabs
bcma specific ipsc t cells targeted amplification ![]() Bcma Specific Ipsc T Cells Targeted Amplification, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/pmc10940063__BLOOD_BLD___2023___020528___mmc1-78-8-34?v=New+England+Biolabs Average 96 stars, based on 1 article reviews
bcma specific ipsc t cells targeted amplification - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Becton Dickinson
rhapsody single cell rna sequencing ![]() Rhapsody Single Cell Rna Sequencing, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/pm34143954-248-5-20?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
rhapsody single cell rna sequencing - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
ATCC
cell line singh 1971 ![]() Cell Line Singh 1971, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/ppr0399447-134-43-40?v=ATCC Average 94 stars, based on 1 article reviews
cell line singh 1971 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
AstraZeneca ltd
target-induced t cell activating nanobodies (titan) platform ![]() Target Induced T Cell Activating Nanobodies (Titan) Platform, supplied by AstraZeneca ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/pmc12258164-135-12-19?v=AstraZeneca+ltd Average 90 stars, based on 1 article reviews
target-induced t cell activating nanobodies (titan) platform - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Aeras Bio Inc
aeras-402 ![]() Aeras 402, supplied by Aeras Bio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lymphocytes+single+cell+suspensions/10__1164_slash_rccm__200910___1484oc-185-8-31?v=Aeras+Bio+Inc Average 90 stars, based on 1 article reviews
aeras-402 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal for Immunotherapy of Cancer
Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer
doi: 10.1136/jitc-2025-013809
Figure Lengend Snippet: Tumor-intrinsic RRBP1 inhibition triggers antitumor immunity. ( A ) Representative images of IHC staining for RRBP1 and CD8 + T cells in BC samples. ( B ) The correlation between RRBP1 expression and CD8 + T-cell infiltration was analyzed based on 96 patients from in-house BC cohort. Scale bar: 50 µm. ( C ) Representative images of IHC staining for RRBP1 expression in PD, SD, PR, and CR samples. Scale bar: 50 µm. ( D ) Bar plot showed the response rates of anti-PD-L1 therapy. Blue bars represent CR/PR, Red bars represent PD/SD. ( E ) Volcano plot of RNA-seq data for shNC or shRRBP1 tumors (n=3). Differentially expressed genes were identified with the threshold of |log2 (fold change) | >1 and FDR<0.05. ( F ) GSEA for DEGs showed the activation of immune-associated pathways in shRRBP1 tumors in the RNA-seq data. ( G ) Representative images of IHC and mIHC staining for RRBP1 and CD8 + T cells in shNC, shRRBP1, control or radezolid tumor tissues. Expression levels of the indicated proteins were displayed. Scale bar: 20 µm. ( H, I ) Flow cytometry showed the percentages of CD8 + T cells in CD3 + cells in shNC, shRRBP1, control or radezolid tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using Spearman correlation analysis ( B ), unpaired two-tailed t-test ( I ). ****p<0.0001. BC, bladder cancer; CR, complete response; FDR, false discovery rate; progressive disease; PR, partial response; PD-L1, programmed death-ligand 1; RNA-seq, RNA sequencing; RRB1, ribosomal-binding protein 1; SD, stable disease; IHC, immunohistochemistry; GSEA, gene set enrichment analysis; DEGs, differentially expressed genes; mIHC, multiplex immunohistochemistry.
Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the
Techniques: Inhibition, Immunohistochemistry, Expressing, RNA Sequencing, Activation Assay, Staining, Control, Flow Cytometry, Two Tailed Test, Binding Assay, Multiplex Assay
Journal: Journal for Immunotherapy of Cancer
Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer
doi: 10.1136/jitc-2025-013809
Figure Lengend Snippet: Single-cell RNA sequencing reveals the difference of CD8 + T-cell subgroup. The UMAP plot of CD8 + T cells subpopulation, color-coded by cell cluster and cell type. ( A ) The expression of markers in each CD8 + T cells subpopulation. ( B ) Bar plot showed the proportion of CD8 + T cells subpopulation in the shNC and shRRBP1 groups. ( C ) The percentage of each CD8 + T-cell clusters in shNC and shRRBP1 groups. ( D ) Heatmap showed the differentially activated pathway among all the CD8 + T-cell clusters. ( E ) The differentially expressed genes in CD8 + T cells between shNC and shRRBP1 groups. ( F ) KEGG analysis for differentially expressed genes showed the enrichment of immune-associated pathways. ( G, H ) mIHC and flow cytometric analysis displayed the tumor-infiltrating IFN-γ + or GZMB + CD8 + T cells in shNC or shRRBP1 tumor tissues. Scale bar: 20 µm. ( I–K ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Isotype control (IgG) or anti-mouse CD8 antibody administered on days –6, –3, and –1 before tumor challenge, with the same dose repeated on days 7, 9 and 11 after tumor challenge. Tumor sizes ( I ), volumes ( J ), and weight ( K ) were measured. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( H, K ) and two-way ANOVA with Tukey’s multiple comparison test ( J ). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. ANOVA, analysis of variance; GZMB, Granzyme B; IFN, interferon; TEX, exhausted T cells; UMAP, Uniform Manifold Approximation and Projection; mIHC, multiplex immunohistochemistry; KEGG, Kyoto Encyclopedia of Genes and Genomes.
Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the
Techniques: Single Cell, RNA Sequencing, Expressing, Injection, Control, Two Tailed Test, Comparison, Multiplex Assay, Immunohistochemistry
Journal: Journal for Immunotherapy of Cancer
Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer
doi: 10.1136/jitc-2025-013809
Figure Lengend Snippet: RRBP1 inhibition promotes antitumor immunity via the CXCL10-CXCR3 axis in BC. ( A ) ScRNA-seq data showed the CXCR3 expression of CD8+T cells in shNC and shRRBP1 groups. ( B ) The correlation between CXCR3 expression and CXCL10 expression or activated CD8 + T cell based on 571 patients from TCGA-BLCA cohort and GSE13507 cohorts. ( C ) MB49 cells were co-cultured with CD8 + T cells, and tumor cells were stained with crystal violet. ( D ) Evaluation of the effect of genetic inhibition of RRBP1 on the cytotoxicity of CD8 + T cells in vitro conditioned culture model. ( E ) Schematic diagram of in vitro CD8 + T-cell migration assays. ( F ) The number of CD8 + T cells passing through the membrane of a Transwell system was analyzed by flow cytometry. ( G–I ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Tumor-bearing mice received intraperitoneal injection of either vehicle or anti-CXCL10 when the tumor volume reached a calculated average of 100 mm 3 . The tumor sizes ( G ), volumes ( H ), and weights ( I ) were measured. ( J ) Representative images of IHC and mIHC staining for CD8, CXCR3, CXCL10, IFN-γ, GZMB in different tumor tissues. ( K ) Flow cytometric analysis of tumor-infiltrating CD8 + T cells, CXCR3 + CD8 + T cells, IFN-γ + CD8 + T cells or GZMB + CD8 + T cells in distinct tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( D, F, I, K ) and two-way ANOVA with Tukey’s multiple comparison test ( H ). The data presented represent on one or three independent experiments. *p<0.01, **p<0.01, ***p<0.001. ANOVA, analysis of variance; BC, bladder cancer; GZMB, Granzyme B; IFN, interferon; RRBP1, ribosomal-binding protein 1; scRNA-seq, single-cell RNA sequencing; IHC, immunohistochemistry; mIHC, multiplex immunohistochemistry; BLCA, bladder urothelial carcinoma.
Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the
Techniques: Inhibition, Expressing, Cell Culture, Staining, In Vitro, Migration, Membrane, Flow Cytometry, Injection, Two Tailed Test, Comparison, Binding Assay, Single Cell, RNA Sequencing, Immunohistochemistry, Multiplex Assay
Journal: Journal for Immunotherapy of Cancer
Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer
doi: 10.1136/jitc-2025-013809
Figure Lengend Snippet: RRBP1 inhibition enhances response to anti-PD-L1 therapy in BC. ( A–D ) The protein expression of surface PD-L1 was analyzed in BC cells or tumor tissues by flow cytometry after RRBP1 inhibition and was shown as the mean fluorescence intensity. ( E–G ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Tumor-bearing mice were received intraperitoneal injection of either vehicle or anti-PD-L1 antibody when the tumor volume reached a calculated average of 100 mm 3 . The tumor sizes ( E ), volumes ( F ), and weights ( G ) were measured. ( H ) Representative images of IHC and mIHC staining for CD8, CXCR3, CXCL10, IFN-γ, GZMB in different tumor tissues. ( I ) Flow cytometric analysis of tumor-infiltrating CD8 + T cells, CXCR3 + CD8 + T cells, IFN-γ + CD8 + T cells or GZMB + CD8 + T cells in distinct tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( B, D, G, I ) and two-way ANOVA with Tukey’s multiple comparison test ( F ). The data presented represent on one or three independent experiments. *p<0.01, **p<0.01, ***p<0.001. ANOVA, analysis of variance; BC, bladder cancer; GZMB, Granzyme B; IFN, interferon; PD-L1, programmed death-ligand 1; RRBP1, ribosomal-binding protein 1; IHC, immunohistochemistry; mIHC, multiplex immunohistochemistry.
Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the
Techniques: Inhibition, Expressing, Flow Cytometry, Fluorescence, Injection, Staining, Two Tailed Test, Comparison, Binding Assay, Immunohistochemistry, Multiplex Assay
Journal: Nature Communications
Article Title: Safety and immunogenicity of a thermostable ID93 + GLA-SE tuberculosis vaccine candidate in healthy adults
doi: 10.1038/s41467-023-36789-2
Figure Lengend Snippet: n = 20–25 biologically independent samples depending on treatment group and time point, see Supplementary Table . a Serum antibody response rate was calculated as at least a fourfold increase in ID93-specific IgG from baseline as measured by ELISA. Response rates were compared using Fisher’s exact test. Differences were detected based on a two-sided test and p ≤ 0.05 (α = 0.05) with Bonferroni adjustment to account for the multiple time points. b – i Data were compared between the two treatment groups using the Wilcoxon rank-sum test with Bonferroni adjustment to account for the multiple time points. b Fold changes in ID93-specific total IgG in serum from baseline as measured by ELISA. ** p = 0.0023 (Study Day 70), * p = 0.0495 (Study Day 84). c Longitudinal plot of group MEPT for ID93-specific total IgG in serum as measured by ELISA. ** p = 0.0061. d – g Longitudinal plots of group MEPT ID93-specific IgG subclasses in serum as measured by ELISA. d IgG1. ** p = 0.0032 (Study Day 70), ** p = 0.0040 (Study Day 84). e IgG2. f IgG3. g IgG4. h Enumeration of ID93-specific IgG-secreting cells in PBMC samples as measured by ELISpot assay. ** p = 0.0085. i Enumeration of ID93-specific IgG memory B cells in PBMC samples as measured by ELISpot assay. Mean values are represented by symbols, and error bars show the 95% CI on the mean. Asterisks indicate a statistically significant difference (* p < 0.05, ** p < 0.01) between treatment groups at that time point after correction for multiple comparisons. Source data are provided as a Source Data file.
Article Snippet: A
Techniques: Enzyme-linked Immunosorbent Assay, Enzyme-linked Immunospot
Journal: Nature Communications
Article Title: Safety and immunogenicity of a thermostable ID93 + GLA-SE tuberculosis vaccine candidate in healthy adults
doi: 10.1038/s41467-023-36789-2
Figure Lengend Snippet: n = 16–25 biologically independent samples depending on treatment group and time point, see Supplementary Tables – . a IFN-γ response rate by ELISpot assay using ID93-stimulated PBMCs and calculated by MIMOSA as a change from baseline using background-subtracted SFUs. b Enumeration of ID93-stimulated IFN-γ-secreting cells in PBMC samples as measured by ELISpot assay. c IL-10 response rate by ELISpot assay using ID93-stimulated PBMCs and calculated by MIMOSA as a change from baseline using background-subtracted SFUs. d Enumeration of ID93-stimulated IL-10-secreting cells in PBMC samples as measured by ELISpot assay. e Response rate by ICS of CD4 + T cells expressing Any Two cytokines among CD154, TNF, IFN-γ, IL-2, IL-21, and IL-4 calculated by MIMOSA as a change from baseline using background-subtracted frequencies and total counts. f Frequencies of ID93-stimulated CD4 + T cells expressing Any Two cytokines in PBMC samples as measured by ICS. g Single cytokine and polyfunctional cytokine CD4 + T cell phenotype at Study Days 70 and 84 as measured by ICS. Proportions of ID93-stimulated CD4 + T cells expressing different single cytokines and cytokine combinations at Study Days 70 and 84 represented by median frequencies. The pie chart area is proportional to the total median frequencies for each readout. a , c , e Response rate plots show mean values represented by symbols, and error bars show the 95% CI on the mean. Response rates were compared using Fisher’s exact test. Differences were detected based on a two-sided test and p ≤ 0.05 (α = 0.05) with Bonferroni adjustments to account for the multiple time points. b , d , f Dot plots represent all background-subtracted values as symbols, with solid lines representing median values and error bars representing the interquartile range. Data were compared between the two treatment groups using the Wilcoxon rank-sum test with Bonferroni adjustment to account for the multiple time points. Source data are provided as a Source Data file.
Article Snippet: A
Techniques: Enzyme-linked Immunospot, Expressing